Skip to main content

Table 1 Primer sequences used in the qPCR experiment

From: Anti-tumor effect of polysaccharide from Pleurotus ostreatus on H22 mouse Hepatoma ascites in-vivo and hepatocellular carcinoma in-vitro model

GENE FORWARD 5ʹ → 3ʹ REVERSE 5ʹ → 3ʹ
Apaf-1 AGTGGCAAGGACACAGATGG GGCTTCCGCAGCTAACACA
Bcl-2 GGTGGGGTCATGTGTGTGG CGGTTCAGGTACTCAGTCATCC
Caspase3 AGAGGGGATCGTTGTAGAAGTC ACAGTCCAGTTCTGTACCACG
Caspase9 CTCAGACCAGAGATTCGCAAAC GCATTTCCCCTCAAACTCTCAA
GAPDH AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA
Cytochrome C GCCTCAGAATAACCATTGTCC TCAAATACCCCAAACTCCAAC