Skip to main content

Table 1 Primers used in this study

From: Development of whole-cell catalyst system for sulfide biotreatment based on the engineered haloalkaliphilic bacterium

Primer name Sequence Description
27 F AGAGTTTGATCCTGGCTCAG sequencing of the 16S rRNA gene
1492R GGTTACCTTGTTACGACTT sequencing of the 16S rRNA gene
sqr-F CACTGCAGGAGGAAGCTTATGCCCAACGAATCA sqr amplification
sqr-R TCCCAGCTCAACGCCCTAGATTCGGCCACG sqr amplification
TER-F TGCTACGTGGCCGAATCTAGGGCGTTGAGCTGGGATTAACCCGGCGAGGCGGAGACCCAACAGAACGGAGCCAGGGAGATGGCGACGCAG pBBR-ptac-sqr plasmid construction
TER-R ACTCGATTGACTGGGGGGCTAGCTGCGTTGAGGAGCCAGCCAGCGCCACTGGGGTCAAACCTTGTCTGTTGACCCTCGTGCCC pBBR-ptac-sqr plasmid construction
CX-F ACTGCATAATTCGTGTCGCT Sequencing primer for pBBR-ck
CX-R AAGAGGAGCAACGCGATCTA Sequencing primer for pBBR-ck
H1_Hin_TER-F AGGACACCTGGGGCACCAACGCCTGAAAGCTTGGCGTTGAGCTGGGATTAACCCGGCG pBBR-ptac-ck construction