Skip to main content

Table 2 Primers used for the quantitative RT-PCR of the target genes

From: Effect of organic acids on growth performance, intestinal morphology, and immunity of broiler chickens with and without coccidial challenge

Target gene Forward/reverse sequence (5′ to 3′) Gen Bank Accession no References
β-actin F: TTGGTTTGTCAAGCAAGCGG NM_205518.1 Li et al. (2019)
R: CCCCCACATACTGGCACTTT
Zonula Occludens-1 F: TGTAGCCACAGCAAGAGGTG XM_413773
R: CTGGAATGGCTCCTTGTGGT
Claudin-1 F: TGGAGGATGACCAGGTGAAGA NM_001013611.2 Shao et al. (2013)
R: CGAGCCACTCTGTTGCCATA
Occludin F: TCATCGCCTCCATCGTCTAC NM_205128.1
R: TCTTACTGCGCGTCTTCTGG