Skip to main content

Table 1 The primer sequences of target genes which used in this study

From: Antibiotic resistance, virulence-associated genes analysis and molecular typing of Klebsiella pneumoniae strains recovered from clinical samples

Target gene Primer sequence (5ʹ to 3ʹ) Annealing temperature (°C) References
acrAB F ATCAGCGGCCGGATTGGTAAA
R CGGGTTCGGGAAAATAGCGCG
53 Wasfi et al. (2016)
tolC F ATCAGCAACCCCGATCTGCGT
R CCGGTGACTTGACGCAGTCCT
51
mdtk F GCGCTTAACTTCAGCTCA
R GATGATAAATCCACACCAGAA
43
iucC F TGGATTGATGCTCAAACTCTG
R TGCATCGCTCATTGACAGTA
  Wasfi et al. (2016)
mrkA F ACGTCTCTAACTGCCAGGC
R TAGCCCTGTTGTTTGCTGGT
55 Vuotto et al. (2017)
mrkD F CCACCAACTATTCCCTCGAA
R ATGGAACCCACATCGACATT
43 Sahly et al. (2008), El Fertas-Aissani et al. (2013)
fimH F GCCAACGTCTACGTTAACCTG
R ATATTTCACGGTGCCTGAAAA
43 Wasfi et al. (2016)
entB F CTGCTGGGAAAAGCGATTGTC
R AAGGCGACTCAGGAGTGGCTT
49
traT F GGTGTGGTGCGATGAGCACAG
R CACGGTTCAGCCATCCCTGAG
55 El Fertas-Aissani et al. (2013)
rmpA F ACTGGGCTACCTCTGCTTCA
R CTTGCATGAGCCATCTTTCA
53 Siu et al. (2011)
ybtS
magA
F GACGGAAACAGCACGGTAAA
R GAGCATAATAAGGCGAAAGA
F GGTGCTCTTTACATCATTGC
R GCAATGGCCATTTGCGTTAG
60 Compain et al. (2014)
htrA F AGAGTTCGCCGTTTTGCCAGGG
R ATCAGAGCGCGGATCTTTGCCG
60 Rasheed et al. (2016)
16 S rRNA F AGCCGACCTGAGAGGGTGA
R TCTGGACCGTGTCTCAGTTCC
55 Marroquin et al. (2019)