Skip to main content

Table 2 List of primers used for siRNA

From: Sulforaphane inhibits self-renewal of lung cancer stem cells through the modulation of sonic Hedgehog signaling pathway and polyhomeotic homolog 3

si-RNA S Sequence (5’ → 3’) AS Sequence (5’ → 3’)
Shh ACAGGCUGAUGACUCAGAGGUGUAA UUACACCUCUGAGUCAUCAGCCUGU
PHC3 CAGAGUUGUUGCUAUACAAGG UUGUAUAGCAACAACUCUGGA