Skip to main content

Table 1 List of primers used for QPCR

From: Sulforaphane inhibits self-renewal of lung cancer stem cells through the modulation of sonic Hedgehog signaling pathway and polyhomeotic homolog 3

Gene Forward (5’ → 3’) Reverse (5’ → 3’)
Shh CGCACCTGC TCTTTGTGG GGAGCGGTTAGGGCTACTCT
Smo TCGCTA CCCTGCTGTTATTC GACGCAGGACAGAGTCTCAT
Gli1 CTG GATCGGATAGGTGGTCT CAGAGGTTGGGAGGTAAGGA
PHC3 AGTGGGGAGAGGAGAAGA GGTGGTGGAACAGAA ACA
β-actin AGAGCTACGAGC TGCCTGAC AGA GCT ACG AGC TGC CTG AC