Skip to main content

Table 2 Gnomoniopsis smithogilvyi LAMP and qPCR primers and probe designed on elongation factor 1-alpha (EF1-α) gene

From: Rapid diagnostics for Gnomoniopsis smithogilvyi (syn. Gnomoniopsis castaneae) in chestnut nuts: new challenges by using LAMP and real-time PCR methods

 Molecular assay Primer/probe name Sequence (5′–3′) Length (bp)
 LAMP Gno_F3 TTGTCGCTCTTATCTGGGA 19
  Gno_B3 CCTTCAGCTTGTCCAGAA 18
  Gno_LoopF GGCTGGTGAGGTTGATGG 18
  Gno_LoopB CTGCTGAGCTCGGAAAGG 18
  Gno_FIP TGGGGTGGAGTTCTAGGCATCTTTACCGTCACTCCTTGG 39
  Gno_BIP GTTGTCATGATCTCGTCGCTGACCCAGGCGTACTTGAAAG 40
 qPCR  Gno_Fw GCGGGAGTGGCTCGTCTT 18
  Gno_Rev GCACCACCGAAAACGAAAA 19
  Gno_Probea FAM-TTTCGCCTGCTGCACA-MGBNFQ 21
  1. aTaqMan MGB dual labeled-probe: 5′ FAM = 6-carboxyfluorescein; 3′ MGBNFQ = Minor Groove Binder (MGB) and Non-Fluorescent Quencher (NFQ)