Skip to main content

Table 1 PCR primers for isolating the core genes of MCO from metagenomes

From: Construction and characterization of a functional chimeric laccase from metagenomes suitable as a biocatalyst

Primer Sequence (5′-3′)
BacBOXdgFw1 ACNTGGGGNTAYAAYGGNWS
BacBOXdgFw2 ACNTGGGGNGTNAAYGGNWS
BacBOXdgRv1 CATCATNCCNYYRTCYTCRTG
BacBOXdgRv2 ADRTGRCARTGRTACATRWA
BacBOXdgFw1GAM CTGCCGCCGACCCGT ACNTGGGGNTAYAAYGGNWS
BacBOXdgFw2GAM CTGCCGCCGACCCGT ACNTGGGGNGTNAAYGGNWS
BacBOXdgRv1GAM GATATCCATCGGACG CATCATNCCNYYRTCYTCRTG
BacBOXdgRv2GAM GACCTCATGCTCCAG ADRTGRCARTGRTACATRWA
BacBOXInfFw CGTCCGATGGATATCACCG
BacBOXInfRv ACGGGTCGGCGGC
MicMCOInfFw GCTGCGCCATGAGGAT
MicMCOInfRv CAGCGTTTTGCGATCGC
MicMCOFwbam AGACGGATCCAGCATTCAACCAGTGGCC
mgBOXInfFw GATCGCAAAACGCTGACNTGGGGNTAYAAYGGNWS
mgBOXInfRv TCCTCATGGCGCAGCADRTGRCARTGRTACATRWA
MicMCOFw ATGAGCATTCAACCAGTGGC
pMALdelMBPRv GGCGAGAGCCGAGGC