Skip to main content

Table 4 Salmonella Kentucky spacer name

From: Subtyping Salmonella isolated from pet dogs with multilocus sequence typing (MLST) and clustered regularly interspaced short palindromic repeats (CRISPRs)

CRISPR locus Spacer namea (position) Spacer DNA sequence (5′-3′)
1 Alt1 (1) AAAAACTAAATCGCAAATAACCAAAAATATCA
1 Conc15 (2) TGGCGATAATGTACGACGAGTTGCCAAAATAT
1 Ana3 (3) ACCAAAACACTGAAAGCCATTCCTCTGGCGTA
1 Ber1 (4) TGACGGACAACGCGGCCAGTTAGTTTTACCTC
1 Ken17 (5) CGCAGCGAAGCGAGGACATAAAAGCATTACGG
1 Ken18 (6) CTGCGCCAGTGCGGTGATATCGTTGCTCATAG
1 Ken19 (7) GCCTACATAGCCGTAAAAGTCGTCCTGACTAA
1 Ken20 (8) TTAATACTGTCAACCAGCGCCCCCTGATTGTC
1 Ken37 (9) TTCGATATGAACGACGCGCAAGCAAAAGAATT
1 Ken38 (10) TTGCAGGCCCTGGTAGTTGACGCTATCGGGGC
1 Ken39 (11) GGCGTTCTGGTTCTGGCGGCTAAGATAAAGGG
1 Newp8 (12) GGGATCAGCACCGACAACCTAAAACCACTGTT
1 Chin1var1 (13) GTTATGAGTTTTGAGCGTTTTGTGCCGTCGCCC
1 Ken21* (14) GCAGCGGCGATACGTGTAAAAATCCCCTGGT
1 Ken22* (15) ATGTGACGATCTGCGGTGGTTACCAGCCAACA
1 Ken40 (16) GCAGCGGCGATACGTGGAAAAAACCCCCTGGT
1 Ken41 (17) AGGTGACGATCTGCGGTGGTTACCAGCCAACA
1 Ken42 (18) GTTATGAGTTTTGAGCGTTTTGTGCCGTCGCC
1 Ken50 (19) TGAGTCTCTATGGTTAGCAATAATGCGCACAT
1 Ken51 (20) CTCTCCAGTTCGGCCAGAAACTCCCTGGTCTG
1 Ken52 (21) GCGCTTTAACGCCCGCTCGCCCCTGAACCCCT
1 Ken53 (22) CTCCTCGCATTTGTGACTTTCTGGATCATCGG
1 Ken40var1 (23) GCAGCGGCGATACGTGGAAAAACCCCCCTGGT
1 Ken23* (24) GGGATCAACACCGACAAACCTAAAACCACTGTT
1 Ken24* (25) GCATCGGCGATATGTGGAAAAAACCCCCTGGTCG
1 Ken25* (26) AAAAACTAAATAAGCAAATAACCAAAAATATCA
1 Ken26* (27) TGAGTCTCTATGGTTAGCAATAATGCGCACATC
1 Ken27* (28) GGCGTTCTGGTTCTGGCGGCTAAGAAAAGGCCG
1 Ken28* (29) GTGGATCATTACCGACATCCTAAAACCACTGTTTC
2 EntB0 (1) GGCTACACGCAAAAATTCCAGTCGTTGGCGCA
2 MonB22 (2) CCAGCCTCCCGTTACGCATATTTGAGGGTTTT
2 MonB24 (3) GCGGCGCTGATTATGATTTCCCGATAATTTAT
2 NiaB2 (4) CTTTCGGGTTGAAAGCAGTAGCACTCATGCCC
2 KenB29 (5) CATTCCGGCGAGACTGAGCAGCGGGCGAACCG
2 ParcB2 (6) GGCCGTCTGCATTGAGCGCAGTTTTAACGCGT
2 KenB30 (7) TACGGATGTGTGACGGAGTCGCGTTTATGGCG
2 KenB31 (8) ACCGTTTCACGGATGAGAGTTGGCGGAAGCGC
2 KenB32 (9) CAGGAATAGACCTCTTTTGCGCTGTGGCTTGC
2 CholB4 (10) TGCGCCACGCCTATACCATCCGAGTTTTGAGC
2 BloB2 (11) AACAAACTGGAGCGAAATTTCGCACATGCCCC
2 KenB33 (12) GTGCGGTTTCTTGCCGAATAGTGCCTCGTACT
2 Tho6 (13) TTCAGAGAATTGCCGCCAATAGAACAGCGCAA
2 KenB42 (14) AGTCTTTCAGTCCATTGGTCTATGATCTCTCG
2 KenB43 (15) ATGATGTATCGGCCATCGCGCCGGGTTATGTT
2 KenB28* (16) AACCAAACTGGAGCGAAATTTCGCACATGCCCCC
2 KenB33* (17) TTCAGAGAATTGCCGCCCATAGACAACCGCAA
2 KenB34* (18) ATGATGTATTCGGCATCGCGCCGGGTTATGTG
2 KenB35* (19) GGCTTCGTGCGCCGCACATCGCAGCGACT
  1. aAn asterisk shows a novel spacer identified in the current study