Skip to main content

Table 1 Sequencing and amplification primers for Salmonella MLST typing

From: Subtyping Salmonella isolated from pet dogs with multilocus sequence typing (MLST) and clustered regularly interspaced short palindromic repeats (CRISPRs)

Gene Primers Size(bp)
Amplification primers (5′-3′) Sequencing primers (5′-3′)
aroC F: CCTGGCACCTCGCGCTATAC F: GGCGTGACGACCGGCAC 826
R: CCACACACGGATCGTGGCG R: AGCGCCATATGCGCCAC
dnaN F: ATGAAATTTACCGTTGAACGTGA F: CCGATTCTCGGTAACCTGCT 833
R: AATTTCTCATTCGAGAGGATTGC R: ACGCGACGGTAATCCGGG
hemD F: ATGAGTATTCTGATCACCCG F: GCCTGGAGTTTTCCACTG 666
R: GAAGCGTTAGTGAGCCGTCTGCG R: GACCAATAGCCGACAGCGTAG
hisD F: GAAACGTTCCATTCCGCGC F: GTCGGTCTGTATATTCCCGG 894
R: GCGGATTCCGGCGACCAG R: GGTAATCGCATCCACCAAATC
purE F: GACACCTCAAAAGCAGCGT F: ACAGGAGTTTTAAGACGCATG 510
R: AGACGGCGATACCCAGCGG R: GCAAACTTGCTTCATAGCG
sucA F: CGCGCTCAAACAGACCTAC F: CCGAAGAGAAACGCTGGATC 643
R: GACGTGGAAAATCGGCGCC R: GGTTGTTGATAACGATACGTAC
thrA F: GTCACGGTGATCGATCCGGT F: ATCCCGGCCGATCACATGAT 852
R: CACGATATTGATATTAGCCCG R: ACCGCCAGCGGCTCCAGCA