Skip to main content

Table 2 PCR primers used in this study

From: Metabolic engineering of Moorella thermoacetica for thermophilic bioconversion of gaseous substrates to a volatile chemical

Name Sequence (5′ to 3′)
JK50 GGTGAAATAATAACTGGACGGTTGCCAAGTACCG
JK51 ATGAAAGCAGGCCGATTACTTCAGATAATCGTAGATCACTTCGG
JK52 TCGGCCTGCTTTCATGCTTG
JK53 AGTTATTATTTCACCATCTCTATTTCCGCC
JK226 GGCCGCCGCCATTTAGCATATCAAGAG
JK227 GCCGCAAATGCTGGTAAAGGCTATC
1181-up-F CGTTCAATAGGAAGACCACAG
1181-dw-R GCAGTAAGCTGTATCGCAATG