Skip to main content

Table 2 Primer sequences of some genes for quantitative RT-PCR

From: Effects of compound probiotics and aflatoxin-degradation enzyme on alleviating aflatoxin-induced cytotoxicity in chicken embryo primary intestinal epithelium, liver and kidney cells

Gene Accession number Primer sequence (5′–3′)
β-actin LO8165 F: GAGAAATTGTGCGTGACATCA
R: CCTGAACCTCTCATTGCCA
IL-6 AJ309540 F: CAAGGTGACGGAGGAGGAC
R: TGGCGAGGAGGGATTTCT
IL-8 AJ009800 F: ATGAACGGCAAGCTTGGAGCTG
R: TCCAAGCACACCTCTCTTCCATCC
iNOS U46504 F: CAGCTGATTGGGTGTGGAT
R: TTTCTTTGGCCTACGGGTC
NF-κBp65 NM_205129 F: GTGTGAAGAAACGGGAACTG
R: GGCACGGTTGTCATAGATGG
TNF-α NM_204267 F: GAGCGTTGACTTGGCTGTC
R: AAGCAACAACCAGCTATGCAC
NOD1 JX465487 F: AGCACTGTCCATCCTCTGTCC
R: TGAGGGTTGGTAAAGGTCTGCT
TLR2 NM_001161650 F: GGGGCTCAGGCAAAATC
R: AGCAGGGTTCTCAGGTTCACA