Skip to main content

Table 2 The primers used in QPCR analyses of the expression of glycolytic genes in this study

From: Increasing glycolysis by deletion of kcs1 and arg82 improved S-adenosyl-l-methionine production in Saccharomyces cerevisiae

Gene Sense primer Antisense primer Refseq GenBank number
hxk2 ctgctccaatggccatcaac aaggtttgttggcctggtct NC_001139.9
pfk1 tggtcttgtcggttccatcg aaggtttgttggcctggtct NC_001139.9
gapdh agtcttttgggtggcggtca acattgacgctggtgccaag NM_001181666.1
pgk1 aggcttctgccccaggttc cagcacgttgtggcaagtc NC_001135.5
pyk cgactcagatgctggattca ccgtttctccagaaagcataa NC_001133.9
\