Strains, plasmids and primers | Relavant characteristics | Source |
---|---|---|
Strains | ||
2842 | S. cerevisiae CGMCC 2842, wild type strain | Cao et al. (2012) |
Ymls1△GAPmK |
S. cerevisiae CGMCC 2842 derivative, mls1△, containing pGAL1-acs2- pPGK1-metK1 | Chen et al. (2016c) |
YGK | S. cerevisiae CGMCC 2842 derivative, containing pYES-KanMX | This study |
Yarg82△ | S. cerevisiae CGMCC 2842 derivative, arg82△ | This study |
Yipk1△ | S. cerevisiae CGMCC 2842 derivative, ipk1△ | This study |
Ykcs1△ | S. cerevisiae CGMCC 2842 derivative, kcs1△ | This study |
Ykcs1△arg82△ | S. cerevisiae CGMCC 2842 derivative, kcs1△, arg82△ | This study |
Ykcs1△pG-kcs1 | Ykcs1△ derivative, containing pGAL1-kcs1 | This study |
Yarg82△pG-arg82 | Yarg82△ derivative, containing pGAL1-arg82 | This study |
Ymls1△kcs1△GAPmK | S. cerevisiae CGMCC 2842 derivative, mls1△, kcs1△, containing pGAL1-acs2- pPGK1-metK1 | This study |
Plasmids | ||
pYES 2.0 | 2 µ, URA3 | Invitrogen |
pYES-KanMX | pYES 2.0 derivative, 2 µ, G418 resistance gene | Cao et al. (2012) |
pGAL1-kcs1 |
pYES-KanMX derivative, 2 µ, G418 resistance, expression of kcs1 of Saccharomyces cerevisiae | This study |
pGAL1-arg82 |
pYES-KanMX derivative, 2 µ, G418 resistance, expression of arg82 of Saccharomyces cerevisiae | This study |
pGAL1-acs2-pPGK1-metK1 | pYES-KanMX derivative, 2 µ, G418 resistance, expression of acs2 of S. cerevisiae and metK1 of Leishmania infantum under control of GAL1 and PGK1 promoter, respectively | Chen et al. (2016c) |
pUG6 | Template plasmid containing loxP-KanMX-loxP elements | Euroscarf |
pSH65 | Cre containing plasmid for loxP-KanMX-loxP cassette recycle | Euroscarf |
Primers | ||
kcs1F | cggggtacc ATGGATACCTCTCACGAAATTCATGA | This study |
kcs1R | cgagctc TCAATCACTAACTTGAGCATCGTC | This study |
arg82F | cggggtacc ATGGATACGGTAAACAATTATAGG | This study |
arg82R | cgagctc CTAGAATTTCATAAAAATATCTAGC | This study |
A | attctgttcttgtttgtctctgttggtt ggattatatctcc TACGCTGCAGGTCGACAAC | This study |
B | cctcacacgtccgagctcttcatcagtc ctattcctacgc TAGGCCACTAGTGGATCTG | This study |
C | tggatacctctcacgaaattcatgata aaatacccgatac TACGCTGCAGGTCGACAAC | This study |
D | caatcactaacttgagcatcgtcattgtatcttggttcag TAGGCCACTAGTGGATCTG | This study |
E | atggatacggtaaacaattatagggttttagagcataaag TACGCTGCAGGTCGACAAC | This study |
F | ctagaatttcataaaaatatctagcaaggtttcaactcct TAGGCCACTAGTGGATCTG | This study |
G | tggccacgacggtactctaacagacggtgatggattgctc TACGCTGCAGGTCGACAAC | This study |
H | tcacgttttcatcataacccttccccggcgttattttcaga TAGGCCACTAGTGGATCTG | This study |
I | atgcaagtcatcggacgtggtggggcaaatatactgattg TACGCTGCAGGTCGACAAC | This study |
J | atggggatcctacgtggttgtggcgatgctgcatccgttg TAGGCCACTAGTGGATCTG | This study |
K | ttatttatttgaagtatgataaattttttggcttgatgtc TACGCTGCAGGTCGACAAC | This study |
L | ggctgtaagtttttgtccaatgggtccatttttcttttgg TAGGCCACTAGTGGATCTG | This study |