Skip to main content

Table 1 Strains, plasmids and primers

From: Increasing glycolysis by deletion of kcs1 and arg82 improved S-adenosyl-l-methionine production in Saccharomyces cerevisiae

Strains, plasmids and
primers
Relavant characteristics Source
Strains
 2842 S. cerevisiae CGMCC 2842, wild type strain Cao et al. (2012)
 Ymls1GAPmK S. cerevisiae CGMCC 2842 derivative, mls1, containing
pGAL1-acs2- pPGK1-metK1
Chen et al. (2016c)
 YGK S. cerevisiae CGMCC 2842 derivative, containing pYES-KanMX This study
 Yarg82 S. cerevisiae CGMCC 2842 derivative, arg82 This study
 Yipk1 S. cerevisiae CGMCC 2842 derivative, ipk1 This study
 Ykcs1 S. cerevisiae CGMCC 2842 derivative, kcs1 This study
 Ykcs1arg82 S. cerevisiae CGMCC 2842 derivative, kcs1, arg82 This study
 Ykcs1pG-kcs1 Ykcs1 derivative, containing pGAL1-kcs1 This study
 Yarg82pG-arg82 Yarg82 derivative, containing pGAL1-arg82 This study
 Ymls1kcs1GAPmK S. cerevisiae CGMCC 2842 derivative, mls1, kcs1, containing pGAL1-acs2- pPGK1-metK1 This study
Plasmids
 pYES 2.0 2 µ, URA3 Invitrogen
 pYES-KanMX pYES 2.0 derivative, 2 µ, G418 resistance gene Cao et al. (2012)
 pGAL1-kcs1 pYES-KanMX derivative, 2 µ, G418 resistance,
expression of kcs1 of Saccharomyces cerevisiae
This study
 pGAL1-arg82 pYES-KanMX derivative, 2 µ, G418 resistance, 
expression of arg82 of Saccharomyces cerevisiae
This study
 pGAL1-acs2-pPGK1-metK1 pYES-KanMX derivative, 2 µ, G418 resistance, expression of acs2 of S. cerevisiae and metK1 of Leishmania infantum under control of GAL1 and PGK1 promoter, respectively Chen et al. (2016c)
 pUG6 Template plasmid containing loxP-KanMX-loxP elements Euroscarf
 pSH65 Cre containing plasmid for loxP-KanMX-loxP cassette recycle Euroscarf
Primers
 kcs1F cggggtacc ATGGATACCTCTCACGAAATTCATGA This study
 kcs1R cgagctc TCAATCACTAACTTGAGCATCGTC This study
 arg82F cggggtacc ATGGATACGGTAAACAATTATAGG This study
 arg82R cgagctc CTAGAATTTCATAAAAATATCTAGC This study
 A attctgttcttgtttgtctctgttggtt ggattatatctcc TACGCTGCAGGTCGACAAC This study
 B cctcacacgtccgagctcttcatcagtc ctattcctacgc TAGGCCACTAGTGGATCTG This study
 C tggatacctctcacgaaattcatgata aaatacccgatac TACGCTGCAGGTCGACAAC This study
 D caatcactaacttgagcatcgtcattgtatcttggttcag TAGGCCACTAGTGGATCTG This study
 E atggatacggtaaacaattatagggttttagagcataaag TACGCTGCAGGTCGACAAC This study
 F ctagaatttcataaaaatatctagcaaggtttcaactcct TAGGCCACTAGTGGATCTG This study
 G tggccacgacggtactctaacagacggtgatggattgctc TACGCTGCAGGTCGACAAC This study
 H tcacgttttcatcataacccttccccggcgttattttcaga TAGGCCACTAGTGGATCTG This study
 I atgcaagtcatcggacgtggtggggcaaatatactgattg TACGCTGCAGGTCGACAAC This study
 J atggggatcctacgtggttgtggcgatgctgcatccgttg TAGGCCACTAGTGGATCTG This study
 K ttatttatttgaagtatgataaattttttggcttgatgtc TACGCTGCAGGTCGACAAC This study
 L ggctgtaagtttttgtccaatgggtccatttttcttttgg TAGGCCACTAGTGGATCTG This study