Skip to main content

Table 1 The primers for the sequences of CAP and ΔCAP

From: High repetitive arginine in the anterior of PCV3 capsid protein is a severe obstacle for its expression in E. coli

Probe/primer The DNA sequence (5′-3′) Tm Amplicon size (bp)
CAPF tttt ggatcc ATGAGACACAGAGCTATATTCAG 55.40 650
ΔCAPF tttt ggatcc CCCACAGCTGGCACATAC 58.09 554
CAPR tttt ctcgag TTCACTTAGAGAACGGACTTG 55.31  
  1. The lowercase letters are protective bases and restriction sites, respectively