Skip to main content

Table 1 Primers used for RT-qPCR

From: Quantitative proteomics revealed modulation of macrophages by MetQ gene of Streptococcus suis serotype 2

Name Oligonucleotide sequence (5′-3′)
Spp1-f ATCTCACCATTCGGATGAGTCT
Spp1-r TGTAGGGACGATTGGAGTGAAA
src-f GAACCCGAGAGGGACCTTC
src-r GAGGCAGTAGGCACCTTTTGT
Clec4e-f GCTCTCCTGGACGATAGCC
Clec4e-r TGCGATATGTTACGACACATCTG
cebpd-f CGACTTCAGCGCCTACATTGA
cebpd-r CTAGCGACAGACCCCACAC
Mcl1-f AAAGGCGGCTGCATAAGTC
Mcl1-r TGGCGGTATAGGTCGTCCTC
ccl9-f CCCTCTCCTTCCTCATTCTTACA
ccl9-r AGTCTTGAAAGCCCATGTGAAA
Rab5a-f GCTAATCGAGGAGCAACAAGAC
Rab5a-r CCAGGCTTGATTTGCCAACAG
GAPDH-F CGTGTTCCTACCCCCAATGT
GAPDH-R TGTCATCATACTTGGCAGGTTTCT