Skip to main content

Table 1 Primers, plasmids and strains used in this study

From: Molecular dynamics simulation and experimental study of the surface-display of SPA protein via Lpp-OmpA system for screening of IgG

Primer, plasmid or strains Description or genotype Source or reference
Primer
 PAF—EcoRI GGGG G AAT TC T GCA AAT GCTGCGCAACAC MWG
 PAR—XhoI GGGG CTCGAG TTTTGGTGCTTGAGCATCGT MWG
 P1 (LPO1-F) NdeI GGGGCATATGAAAGCTACTAAACTGGTACTGGGCAACCCGTATGTTGGCTTTGAAATGGG Tafakori et al. (2012)
 LPOTA, EcoRI GGGGGAATTCGCTCCCGGAATGCCGTTGTCCGGACGAGTG CC Tafakori et al. (2012)
 PET 26b
 PET 26b-lOAE (pLOAa)
T7 promoter, an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His·Tag
Vector for construction and expressing of chimeric protein containing lpp′-ompA, Elongatus and Chitin Binding domain
Qiagen
Novagene
Constructed in this study
Constructed in this study
Strain
 BL21 DE3 F-ompT gal dcm lon hsdSB (rB- mB-) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5] Stratagene
 Top 10
Staphylococcus aureus
F′[lacIq Tn10 (tetR)] mcrA Δ (mrr-hsdRMS-mcrBC) ϕ 80lacZΔM15 ΔlacX74 deoR nupG recA1
araD139 ∆(araleu) 7697 galU galK rpsL(StrR) endA1 λ−
Invitrogen