Skip to main content

Table 2 Primers used for quantitative real-time PCR analysis

From: Fermented Astragalus in diet improved laying performance, egg quality, antioxidant and immunological status and intestinal microbiota in laying hens

Primers Sequences 5′ ~ 3′ Size
IFN-γ-F AACAACCTTCCTGATGGCGT 107 bp
IFN-γ-R TGAAGAGTTCATTCGCGGCT  
β-actin-F TATGTGCAAGGCCGGTTTCG 170 bp
β-actin-R CAATGGGGTACTTCAGGGTCAG  
TNF-α-F GCCCTTCCTGTAACCAGATG 71 bp
TNF-α-R ACACGACAGCCAAGTCAACG