Skip to main content

Table 2 Primers used in plasmids construction

From: Generation of a recombinant chickenized monoclonal antibody against the neuraminidase of H9N2 avian influenza virus

Primer name Sequence
LCF-Sac CGAGCTCATGAAGTCACAGACCCAGGTC
LCR-Nhe CGGCTAGCCTAACACTCATTCCTGTTGAAGCTC
FdF-Sac CGAGCTCATGAGAGTGCTGATTCTTTTGTGG
FdFcR GGACCTGCACAATTTTCTTGTCCACCTTGGTGC
FdFcF GGACAAGAAAATTGTGCAGGTCCTCCACCC
FcR-Nhe CGGCTAGCTTATTTACCAGCCTGTTTCTGCAG