Skip to main content

Table 1 Primer used in our study

From: Betalain exerts a protective effect against glaucoma is majorly through the association of inflammatory cytokines

Gene Primer Sequence (5′–3′) Annealing
VEGF F CAAACCTCACCAAAGCCAGC 59
R GCGCTTTCGTTTTTGACCCT
BDNF F GTGGTTACCTGACTGGGCTC 58
R TCCCTGAGTCACAGTGGACA
Caveolin-1 F GCGCCTTTCCCCCTCTATAC 57
R GGGCTTGTAGATGTTGCCCT
TGF-β F CCACGTGGAAATCAATGGGA 59
R TGCCGTACACAGCAGTTCTT
Myocilin F TACCTCGGGGCTTGTACAGT 58
R CCATACAGCTTGGCAAAAAGCA
Neuroserpin F GCTGTGGCCTCAGGAATGAT 58
R GTGCATGACTCGTCCCATGA
GAPDH F TCTCTGCTCCTCCCTGTTCT 57
R TACGGCCAAATCCGTTCACA