Skip to main content

Table 1 Primer sets for amplification of the whole genome of F/98

From: Effect of the selection pressure of vaccine antibodies on evolution of H9N2 avian influenza virus in chickens

Prime name Prime sequence (5′–3′) of forward primer Prime sequence (5′-3′) of reverse primer Length (bp)
PB2
 PB2-1 TATTGGTCTCAGGGAGCGAAAGCAGGTC ACTGCCTTTATCATGCAGTCATC 1376
 PB2-2 GCAACCGCTATTTTTAGGAAAGC ATATGGTCTCGTATTAGTAGAAACAAGGTCG 1276
PB1
 PB1-1 AGCAAAAGCAGGCAAACCATTTGAA GAGGATTGGAGCCCTTCCCACCA 1984
 PB1-2 ATGATGATGGGCATGTTCAACATG AGTAGAAACAAGGCATTTTTTCA 1120
PA
 PA-1 AGCTAAAGCAGGTACTGATTCAAAA ATCCATCTTGATTCCGTCAATTC 1316
 PA-2 GGCACCTGATAAAGTTGACTTTGA AGTAGAAACAAGGTACTTTTTTGGA 1138
HA TATTCGTCTCAGGGAGCAAAAGCAGGGG ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT 1683
NP TATTCGTTCTCAGGGAGCAAAAGCAGGGTA AGTAGAAACAAGGGTATTTTTCTT 1497
NA TATTGGTCTCAGGGAGCAAAAGCAGGAGT ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTT 1417
M TATTCGTCTCAGGGAGCAAAAGCAGGTAG ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTT 982
NS TATTCGTCTCAGGGAGCAAAAGCAGGGTG ATATCGTCTCGTATTAGTATAAACAAGGGTGTTTT 844