Skip to main content

Table 1 Specific primers for qRT-PCR of Burkholderia multivorans WS-FJ9 phosphate-solubilizing genes

From: Identification, cloning and expression patterns of the genes related to phosphate solubilization in Burkholderia multivorans WS-FJ9 under different soluble phosphate levels

Gene namePrimer (5′-3′)
PhoAF:ATGTCGACTATCAAGCGCAT
R:CTCACCCACCTTGTAGATGC
PhoRF:ATCCCGATTTCGTCCGCTACCT
R:CGTTCGAGTTCCGTGATGTCCTG
AP-1F:GAAGAAAACCTGGATCCGCG
R:GGAAGGCGCCGTACAGGTT
AP-2F:GGTGCGCAACATCGTGGTG
R:CCAGACCTTCGGCAGGGTG
AP-3F:CGCCTCGTCTGTGGATCTC
R:GAAGGCGATCTTGGTCAGC
HlyBF:ATGTATTTCGGCACGACGCT
R:AGGAACGAGGTGGTGAGGGT
GspEF:AACAGGCCTCGGACATCCA
R:GTCGAGTTGCGCCATGATTT
GspFF:ATCGTGCTGGCGTTCACCTAT
R:ACCAGTGCCGCACGAAATC