Skip to main content

Table 2 Primers used in this study

From: Enhancing A82846B production by artificial attB-assisted overexpression of orf10orf11 genes in Kibdelosporangium aridum SIPI-3927

PrimersPurposeSequence (5′–3′)
orf35-attB-F/RAmplification of orf35-attB for construction of pSET1139-attBCTGCAGGTCGACTCTAGACCTCGATCCGGACCACGAGCAC
CCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGCGGTCAATATCCGTACCGGCT
orf36-attB-F/RAmplification of orf36-attB for construction of pSET1139-attBTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACTCACCGGTCGATCAAGGG
GCGCGCGGCCGCGGATCCCGAGACGCTGACCACTGGGCAG
kasO*P-F/RAmplification of kasO*P promoter for construction of pSET152-vcm8CAAGCTTGGGCTGCAGGTCGACTCTAGATGTTCACATTCGAACCGTCTC
ACCACATCGAAGTCTTCGACCGACATATGGACACTCCTTACTTAGACTG
vcm8-F/RAmplification of vcm8 for construction of pSET152-vcm8GTCTAAGTAAGGAGTGTCCATATGTCGGTCGAAGATTTCGATGTTGTG
TCGATATCGCGCGCGGCCGCGGATCCTCAGGCCGGGTGGTGCGGCAGC
orf10-F/RAmplification of orf10 for construction of pSET152-orf10CAGTCTAAGTAAGGAGTGTCCATATGTCGGTCGAAGACTTCGATGT
TCGATATCGCGCGCGGCCGCGGATCCTCATGCCGGATGGTGCGGCAGCC
orf11-F/RAmplification of orf11 for construction of pSET152-orf11GTCTAAGTAAGGAGTGTCCATATGCGCGTGTTGATTACGGGGTGTG
TCGATATCGCGCGCGGCCGCGGATCCTCAGGCGGGAACAGTCGGC
orf12-F/RAmplification of orf12 for construction of pSET152-orf12GTCTAAGTAAGGAGTGTCCATATGCGTGTGCTGTTGGCGACGTGTG
TCGATATCGCGCGCGGCCGCGGATCCTTACGCGGAAACAGTCGGC
orf13-F/RAmplification of orf13 for construction of pSET152-orf13GTCTAAGTAAGGAGTGTCCATATGCGTGTGTTGTTGTCGACGGCTG
TCGATATCGCGCGCGGCCGCGGATCCTTACGCGAGAACAGCCGAC
orf10orf11-F/RAmplification of orf10orf11 for construction of pSET152-orf10orf11GTCTAAGTAAGGAGTGTCCATATGTCGGTCGAAGACTTCGATGT
TCGATATCGCGCGCGGCCGCGGATCCATGTCAGGCGGGAACAGTCGGCTTTT
attB-F/RAmplification of artificial attB site in K. aridumCCGCGGTGCGGGTGCCAGGGCGTGC
CTCTCCCCTCTGATCGAGGACCAG
  1. The Italicized part represents attB sequence; underline represents restriction enzyme cutting site