Skip to main content

Advertisement

Table 2 Primers used in this study

From: Development of a multiplex PCR assay for the simultaneous and rapid detection of six pathogenic bacteria in poultry

SpeciesPrimersSequenceProducts (bp)
Escherichia coliphoA P1GCACTCTTACCGTTACTGTTTACCCC1001
phoA P2TTGCAGGAAAAAGCCTTTCTCATTTT 
Pasteurella multocidaKMT1 P1TTAACAGAGAGGTGAAAAATACCCCTA755
KMT1 P2CTTTACGCTGATTAATATTGTGCTGA 
Proteus mirabilisureR P1CTGGTGGCTCATTCATCT509
ureR P2ACAGTTAGGCGGTGGTAT 
Pseudomonas aeruginosatoxA P1TTCGTCAGGGCGCACGAGAGCA363
toxA P2TCTCCAGCGGCAGGTGGCAAG 
Salmonella spp.invA P1AACCAGCAAAGGCGAGCAG256
invA P2AATACGATGCTGTTATCGTCCAG 
Staphylococcus aureusnuc P1CCTGAAACAAAGCATCCTAAAAA155
nuc P2TAAATATACGCTAAGCCACGTCCAT