Skip to main content

Table 2 Primers used in this study

From: Development of a multiplex PCR assay for the simultaneous and rapid detection of six pathogenic bacteria in poultry

SpeciesPrimersSequenceProducts (bp)
Proteus mirabilisureR P1CTGGTGGCTCATTCATCT509
Pseudomonas aeruginosatoxA P1TTCGTCAGGGCGCACGAGAGCA363
Salmonella spp.invA P1AACCAGCAAAGGCGAGCAG256
Staphylococcus aureusnuc P1CCTGAAACAAAGCATCCTAAAAA155