Skip to main content

Advertisement

Table 1 Primer characteristics

From: Two-step genomic sequence comparison strategy to design Trichoderma strain-specific primers for quantitative PCR

Genome location or referenceCodePrimer setSequence (5′–3′)Fragment size (bp)
>T37_S00003:2560926-2576741P1T-1FGTGGCGAAAACTCTCATACTCGT127
T-1RCTATAAATCAAGTTTGCCGTGCT
P2T-2FGCCCACTCAAATTGCGAACATA143
T-2RCGACGACGACATACTCATCAATC
P3T-3FTGGTCTAACGGCTCTTCAACAT136
T-3RAGGCACTGACACTTTATCTGGT
P4T-4FCGACGGAACTACATGATAAGCAA102
T-4RCCTAAATGAATGAGCCTCGTCT
>T37_S00005:2001401-2006364P5T-5FTGTCTACCAATCACCAGTTTACG134
T-5RCACCATTGTTCCATCCATTACCA
P6T-6FTGGTAATGGATGGAACAATGGT126
T-6RCCTCGCTTCACTGACTGGA
>T37_S00007:2096560-2099766P7T-7FGTGGCGTCCTTGGTCATTG128
T-7RACACAGAGCGTAGGCATAGAT
P8T-8FTATGCTGGTGGTGGTCTTAGTG136
T-8RGTAATGGCTGAATAGGTGCGATAA
>T37_S00017:678513-681994P9T-9FTCTCTACAAGCTCCAAGACCAC114
T-9RATTGTCATTGTGCATTTATCGAG
P10T-10FCTCCATCACCTGCATTTAGTGT143
T-10RTCGACAGTGATTCATAAGGCATC
GFP fragmentP11gfp-FAGAAGAACGGCATCAAGGTG171
gfp-RTCTCGTTGGGGTCTTTGCT
HYG fragmentP12hyg-FCATTGACTGGAGCGAGGC99
hyg-RCGTCTGCTGCTCCATACAA
GFP-HYG fragmentP13gfphyg-FGCCGATAGTGGAAACCGA140
gfphyg-RCTTGTGGCCGTTTACGTCG
López-Mondéjar et al. (2010) and Beaulieu et al. (2011)ITS1ITS1-SACAACTCCCAAACCCAATGTGA207
ITS1-RCGTTGTTGAAAGTTTTGATTCATTT