Skip to main content

Table 2 Primers used in this study

From: The significance of aspartate on NAD(H) biosynthesis and ABE fermentation in Clostridium acetobutylicum ATCC 824

Primers Sequence (5′–3′) Sources and references
Primers for gene amplification
 nadA-F AGGAGGTTAGTTAGA GGATCC TCACATACACCCCTTATTTCCAAC This work
 nadA-R ACGACGGCCAGTGCC AAGCTT TCACCTTCCAAGTATTAACATATTT This work
 nadB-F AGGAGGTTAGTTAGA GGATCC ATGAATATTCAAACTGACGTATTAAT This work
 nadB-R ACGACGGCCAGTGCC AAGCTT TCAAATGTTGACCAATTCATTTTTC This work
 nadC-F AGGAGGTTAGTTAGA GGATCC ATGAATTGGTCAACATTTGATGAT This work
 nadC-R ACGACGGCCAGTGCC AAGCTT TTATTTTTCATTTCTTAAGTTTTTCATGC This work
 NadC′-F ACATCCCCCTTTCGC CAGCTG GAATCCATTTTGGGGGAAAAG This work
 NadC′-R CAGGCTTCTTATTTTTAT GCTAGC TTATTTTTCATTTCTTAAGTTTTTCATGC This work
 pMTL-F TGAAGTACATCACCGACGAGCAAG This work
 pMTL-R TGCTGCAAGGCGATTAAGTTGGGT This work
 pMTL-R CCTGTTGAACCATTAGCTAAGGA This work
Primers for RT-PCR
 nadA(RT)-F CAAAGACCTGAGGTGCAGGAA This work
 nadA(RT)-R GCCATTGGACAGCCAGCTT This work
 nadB(RT)-F CTTCAGGCGGTATAGGTGG This work
 nadB(RT)-R TCGCGAACGTCTATGTTATG This work
 nadC(RT)-F AAACGCTTAGAGGGCACAGG This work
 nadC(RT)-R TGCCGTCAGAAAGACCAAATC This work
 CAC2679-F GACATTACTTCAAACGAACCTG Liao et al. (2018)
 CAC2679-R CCCTTAGCCCATTTATTCCT Liao et al. (2018)