Skip to main content

Table 1 The primers and gene sequences

From: Recombinant expressing angiopep-2 fused anti-VEGF single chain Fab (scFab) could cross blood–brain barrier and target glioma

  5′ → 3′ Underline
ANG gene ACCTTCTTTTACGGCGGAAGCAGGGGCAAGAGAAACAACTTCAAGACAGAGGAGTAC  
PelB gene ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC  
Linker 1 TCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGT  
Linker 2 GGAGGCGGTGGCTCAGGAGGTGGTGGGAGCGGTGGCGGCGGATCC  
Light chain F: GGAATTCCATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGC NdeI
R: CGGGATCCGGAGCACTCGGTGGGG BamHI
Fd of heavy chain F: GGAATTCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGC
TCTGAGGGTGGC
EcoRI
R1: CACCGCTTCCGCCTCCGCCGTGGGTCTTGTCGCAGGACTTG Overlap
R2: CCGCTCGAGGTGGGTCTTGTCGCAGGACTTG XhoI
ANG F: CAAGTCCTGCGACAAGACCCACGGCGGAGGCGGAAGCGGTG Overlap
R:GCTCTAGATTATTAGTGGTGGTGGTGGTGGTGATGGTGATGGTGATGATGGT XbaI