Skip to main content

Table 1 Sequences of hydrophobic peptide fusion lyase primers

From: External lysis of Escherichia coli by a bacteriophage endolysin modified with hydrophobic amino acids

Peptide Sequence Notations
3-3 GGAATTCCATATGAAAATTTCATCCAATGGCCT Sharing upstream primers
ACGCGTCGACTCACGGCAGAATTGCTGCCGCCACACCGCG 3 hydrophobic peptides added
3-5 ACGCGTCGACTCAGGGAGCAGCGACGAATGCTGCCGCCACACCGCGTT 5 hydrophobic peptides added
3-7 ACGCGTCGACTCATATTATGGGAGCAGCGACCCAGAATGCTGCCGCCACACCGCGTT 7 hydrophobic peptides added
3-12a ACGCGTCGACTCACGGCGCAATAATCAGCACGAACACAATCAGAATGAATGCTGCCGCCACACCGCGTTCAATAGC 12 hydrophobic peptides added
3-12b ACGCGTCGACTCACGGCGCAATCAGGTTCACAATCAGAATCACAATGAATGCTGCCGCCACACCGCGTTCAATAGC 12 hydrophobic peptides added