Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used in this study

From: Stable and transient transformation, and a promoter assay in the selective lignin-degrading fungus, Ceriporiopsis subvermispora

Primer name Sequence (5′-3′) Purpose
hph-1 ATGAAAAAGCCTGAACTCACCGCGACG Probe in Southern blot and genomic PCR for pCsGi-hph
hph-2 CTATTCCTTTGCCCTCGGACGAGTGCT Probe in Southern blot and genomic PCR for pCsGi-hph
Csbar_F TCAGGTGCGTGAAGTGTACT Probe in Southern blot and genomic PCR for pCsbtubi-hph
hph-4_R TACGTAGGTAGTGGTAGACT Probe in Southern blot and genomic PCR for pCsbtubi-hph
CsGPD-TATAmut_R GAGGGTTGATATGGGGCGAT Site-directed mutagenesis for p201[A60C]
CsGPD-8 ACCCCGCCGCTTTTTCCCTTCAT Site-directed mutagenesis for p201[A60C]
CsGP-PRO5 CGCCAAGCTTACTCATCCAGAATACACTCG PCR amplification of Csgpd promoter, and the first exon and intron
CsGP-PRO3int CTGCAATTGTCCGTCAGTAC PCR amplification of Csgpd promoter, and the first exon and intron
Csbtub-pro-R1 GCTAGAGACGATATCAGTT PCR amplification of Csbtub promoter
Csbtub-Hind_F2 AGGCTCTAAGCTTGTACCGAGTGCAT PCR amplification of Csbtub promoter