Skip to main content

Table 2 List of primers used in the study (restriction sites italicized)

From: Isolation and identification of a TetR family protein that regulates the biodesulfurization operon

Primer Name Resulted fragment Sequence (5′→3′)
GAA-F DszA GGAATTCCATATGGCTCAACGGCAACAACTGCATCTGGCG GTTTC
GAA-R DszA CCGCTCGAGGTGTGTCGAGGTGTGTCGAGGATGCCGGTA TCAAGTTCTGAACCGG
PS-18 Pdsz F GAGCAGATCTGGCCATGATCGACCGCCTCGTCCATCACGC
PS-19 Pdsz R CAGTCATATGCGCGTATGTGTCCTCTAACCGTAAATAGCG
TB1 385 bp Pdsz GATCGATCTCGCGGCCATGATCGACCGCCTCG
TB2 315 bp Pdsz GATCGAGTCTACCGAGACCTGGGCCGCGTCC
TB3 239 bp Pdsz GATCGAGTCTGTCAACTTTCAACCGCCGAAAAGGGGTGAGATTTCAGCC
TB4 151 bp Pdsz GATCGAGTCTCCACCGTTAATCTGACAGTCCCGCCCGAACTGCTG
TB5 63 bp Pdsz GATCGAGTCTGGGGTGACACTTCTTGGCGACACGAAGCACTCC
PS18 EcoRV 385 bp Pdsz GAGCGATATCGGCCATGATCGACCGCCTCGTCCATCACGC
TetR-F 681 bp TetR F CTAGCATATGTTGTCACCACGAGGCCAGAC
TetR-R 681 bp TetR R CTAGAAGCTTGCGCGGCAGGATGCCGTCGAG
DBRR-F 687 bp DBRR F CTAGCATATGATGAGCACGGACAAGACACGCGTCC
DBRR-R 687 bp DBRR R CTAGAAGCTTTCACGGCGCCCCGCGAACGAACCGG
LuxR-F 684 bp LuxR F CTAGCATATGGTGCCGATCACCGTAGTCATCGCAG
LuxR-R 684 bp LuxR R CTAGAAGCTTTCACTTGATGCCGTTCTCGTAGGCG
Fis-F 1467 bp Fis F CTAGCATATGATGGCACGACCCCGGAAGCCTGAAGACCCA
Fis-R 1467 bp Fis R CTAGAAGCTTATCCAGACGCGTGGCGATGTATCGGGAGTA
qPCR-dszB 116 bp dszB F GCGTCTACTCGGCATCAC
qPCR-dszB 116 bp dszB R CCGAAGCCGACACTCCTATT
qPCR-dszC 94 bp dszC F GCCTTCATTGTCGCCTTCAT
qPCR-dszC 94 bp dszC R GCGCGATCCCTAAATAGACG