Skip to main content

Table 1 The primer and beacon probe sequences

From: Evaluation of a novel micro/nanofluidic chip platform for the detection of influenza A and B virus in patients with influenza-like illness

Subtypes of influenza viruses Primer or probe Sequence (5′-3′) Length (bp)
Influenza A MP Forward primer CACTDGGCACGGTGAGCGTGAA 201
Reverse primer AATTCTAATACGACTCACTATAGGGAGATTCTAACCGAGGTCGAAACG
Beacon probe FAM-CCCGTCTTTAGCCAYTCCATGAGAGCCTCACGGG-BHQ1
Influenza A(H1N1)pdm09 HA Forward primer ATGATAATACCAGATCCAGCA 173
Reverse primer AATTCTAATACGACTCACTATAGGGAGAGTTCAAGCCGGAAATAGCAAT
Beacon probe FAM-CCCGTAATGCATATCTCGGTACCACTAGATTTCACGGG-BHQ1
Influenza A(H3N2) HA Forward primer CATAAGGGTAACAGTTGCT 188
Reverse primer AATTCTAATACGACTCACTATAGGGAGAATGCTACTGAGCTGGTTCA
Beacon probe FAM-CGCGTTTGAGGGTCTCCCAATAGAGCATCACGCG
Influenza B MP Forward primer CCAAAACTGTTTCACCCATT 168
Reverse primer AATTCTAATACGACTCACTATAGGGAGAACAATAAACAGAGAGGTATC
Beacon probe FAM-CCCGTTCAATACCTCCATGTTGTCAGAGAGTACGGG-BHQ1
  1. Four pairs of primers and molecular beacon probes specific for influenza A virus matrix protein (MP) gene, influenza A(H1N1)pdm09 hemagglutinin (HA) gene, influenza A(H3N2) HA gene, and influenza B virus MP gene were employed to detect four subtypes of influenza viruses