Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Characterization of GH2 and GH42 β-galactosidases derived from bifidobacterial infant isolates

Gene Primer Sequence Restriction enzymes
Bbr_0010 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatgcatcaccatcaccatcaccatcacc EcoRV
Rv tgcgcaTCTAGAtcagatgagttcgagtgtcac XBaI
Bbr_0285 Fw tgcatcGATATCatgcatcaccatcaccatcaccatcaccatcacatggagcgaatccaatacccc EcoRV
Rv tgcgcaTCTAGAtcacacctgcacgtagccg XBaI
Bbr_0310 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatggggacgacaggacacagc EcoRV
Rv tgcgcaTCTAGAtcaactcttttcgattgcg XBaI
Bbr_0420 Fw tgcatcCCCGGGcatcaccatcaccatcaccatcaccatcacatgactactcgtagagc XmaI
Rv ctcgaaTCTAGActagcaggacgttttagcg XBaI
Bbr_0529 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatggaacatcgcgaattcaag EcoRV
Rv tgcgcaTCTAGAttacagctttaccaccagcac XBaI
Bbr_1552 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatgaacacaaccgacgatcag EcoRV
Rv tgcgcaTCTAGAtcagatgagttcgaggttcac XBaI
Bbr_1689-1690 Fw tgcatcCAGCTGcatcaccatcaccatcaccatcaccatcacatgagcaagcagaacgattg PvuII
Rv tgcgcaTCTAGAgctggcatcttcctgaacg XBaI
B7017_2031 Fw tgcatcGAATTCcatcaccatcaccatcaccatcaccatcacatgaccgacaccatggcacacacacaacc EcoRI
Rv tgcatcTCTAGActgatgatgaaggatgactgaagccg XBaI
B216_06500 Fw tgcatc ATTTAAAT atg catcaccatcaccatcaccatcaccatcac gtcaataccgttagggttgt SwaI
Rv tgcatc TCTAGAcccggggagactcgcgagagt XBaI
B216_08266 Fw tgcatcATTTAAATcatcaccatcaccatcaccatcaccatcacatgagtaaacgcagaaagcacag SwaI
Rv tgcgcaTCTAGAgtatgtcgcgtgtcaccg XBaI
B216_08730 Fw tgcatcGATATCatgcatcaccatcaccatcaccatcaccatcacgtgcgcgcgcgacgtgactttg EcoRV
Rv tgcatc TCTAGA aacgttgaaatagagccggaaac XBaI
B216_09411 Fw tgcatc ATTTAAATatg catcaccatcaccatcaccatcaccatcac ttcattccccggtactacg SwaI
Rv tgcatc TCTAGA atccgatacccgtacccgtg XBaI
B216_09623 Fw tgcatcATTTAAATcatcaccatcaccatcaccatcaccatcacatgaacacaaccgacgatcagc SwaI
Rv tgcgcaTCTAGAatgagcgagaggacctggcg XBaI
B8809_0321 Fw tgcatcATTTAAATcatcaccatcaccatcaccatcaccatcacatgactactcatagagcatttag SwaI
Rv tgcatc TCTAGAcattctagcgcggtttag XBaI
B8809_0415 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatggaacgtaaagagttcaagtgg EcoRV
Rv tgcatcTCTAGAccgttgggtaattaggcgct XBaI
B8809_0611 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatgacagacgtcacacatgtcg EcoRV
Rv tgcatc TCTAGAtgcacggtggactatcggatc XBaI
B8809_1361 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatgcagcatcccatccccaccac EcoRV
Rv tgcatc TCTAGAcagcacgataaagaagctccctcg XBaI
Blon_2016 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatggaacatagagcgttcaagt EcoRV
Rv tgcatcTCTAGAcggctccctgctgcgatga XBaI
Blon_2123 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatggtgcgtgcgcgacgtgactt EcoRV
Rv tgcatcTCTAGAaccatgtacgtcggcaccgt XBaI
Blon_2416 Fw tgcatcGATATCcatcaccatcaccatcaccatcaccatcacatgaccgacaccatggcaca EcoRV
Rv tgcatcTCTAGAcggttgctgacttgggatat XBaI