Skip to main content

Table 1 Primers used in current study

From: Assessment of 16S rRNA gene primers for studying bacterial community structure and function of aging flue-cured tobaccos

Primer pairs Primer sequence (5′–3′) M References
8F TGGAGAGTTTGATCCTGGCTCAG V1V2V3 Sun et al. (2014)
533R TACCGCGGCTGCTGGCAC
336F GTACTCCTACGGGAGGCAGCA V3V4 Munyaka et al. (2015)
806R GTGGACTACHVGGGTWTCTAAT
515F GTGCCAGCMGCCGCGGTAA V4V5 Tuan et al. (2014)
909R CCCCGYCAATTCMTTTRAGT
799F AACMGGATTAGATACCCKG V5V6V7 Beckers et al. (2016)
1193R ACGTCATCCCCACCTTCC
  1. Primers are indicated as forward (F) or reverse (R)
  2. M, Hypervariable region of the 16S rRNA operon targeted by primer pairs