Skip to main content

Table 2 Primers used in this study

From: Identification of two genes required for heptadecane production in a N2-fixing cyanobacterium Anabaena sp. strain PCC 7120

Primers Oligonucleotide sequences (5′ → 3′) Description
ZR165 GATCTCCCGGGCTAGCGGCCGCAATTGACGTCTCGAGA Annealed oligonucleotides ZR165/ZR166 ligated to BglII-SpeI digested pRL278 to produce pZR824
ZR241 tggaTCCAACTCTACAGGAATTGTCTG ZR241,242 primer pair amplifying alr528384 ORF (2.7 kb); in knockout mutant with GFP-Spr cassette, primers amplify 4.7 kb
ZR243 CAAAAAGCGGCcGCTGAAGGTAAAATC ZR243,244 primer pair for site-directed mutagenesis to introduce NotI site at 997 bp of alr528384 region
ZR1584 atgcatatgctagcgacgtcggATCCCTTAACTTACTTATTAAATAATTTATAG Primers ZR1584/ZR1585 PCR amplified 1921 bp Cmr/Emr cassette (NsiI/NdeI-NheI/BamHI-Emr/Cmr cassette-EcoRV/BglII/XhoI/XmaI/SmaI) from pRL271 ligated to pCR2.1-TOPO to produce pZR2222
ZR261 CAAGAATTGGGACAACTCCAGTG ZR261, 1602 primer pair for verifying insertion of P-alr5283-P-alr5284 in pZR2223 shuttle vector (construction pZR2239)
ZR1603 tcccgggtacCTAAACCAGCAGTGGTCTAAACC ZR1602, 1603 primer pair amplifying P-alr5283-P-84 (2.2 kb); amplification retains promoters for both genes
ZR1606,1607 primer pair amplifying alr528384 (2 kb); amplification includes promoter for alr5284 only
ZR1606-1608-1609-1607 overlap PCR (1.7 kb)
(1) Primer pair ZR1606, 1608 amplify alr5283 ORF
(2) Primer pair ZR1609, 1607 amplify alr5284 ORF
(3) Primer pair ZR1606, 1607 using template fragments from steps 1 and 2 for PCR overlap, combining the fragments (1.7 kb)
LK2406 TTAAGGGCCCGGGAGATCTAGACCGGTACTAGTC Annealed oligonucleotides LK2406/LK2407 ligated to AflII digested pZR606 to produce pZR666; ApaI-XmaI-BglII-XbaI-AgeI-SpeI multiple cloning sites (MCS)
  1. Sp: spectinomycin resistance; ORF: open reading frame; GFP: green fluorescent protein; MCS: multiple cloning sites, RBS: ribosome-binding site, P-: promoter, PCR: polymerase chain reaction