Skip to main content

Table 3 The sequence of FITC probe designed for labeling LAMP primer

From: Probe-free label system for rapid detection of Cronobacter genus in powdered infant formula

Primer name Sequence (5′–3′)
FITC probe CTCAAACTCGCAGCACGAAGACT