Skip to main content

Table 3 Oligonucleotide primers used in this study

From: Development of a high throughput yeast-based screening assay for human carbonic anhydrase isozyme II inhibitors

Primer name Primer sequence (5′–3′)
A. Primers used in the PCR amplified disruption cassettes for gene disruption
 D-ERG3_Fw ATTTCTATCTTTCTTATCAATTCGTTTTTTCATTCACTTGTCAGCTGAAGCTTCGTACGC
 D-ERG3_Rv TCTTGAACGTGAAAGAAAGAAAAAAGATGAGACAAACAAGATAGGCCACTAGTGGATCTG
 D-NCE103_Fw TACAAATTTCAATTATTACACATCAGACAGCTGAAGCTTCGTACGC
 D-NCE103_Rv CCCCGTCTACTTTGTAAATGTCTTTCTATTTCAATGAATGGTAGGCCACTAGTGGATCTG
 D-TRP1_Fw GTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGACAGCTGAAGCTTCGTACGC
 D-TRP1_Rv CTATTTCTTAGCATTTTTGACGAAATTTGCTATTTTGTGCATAGGCCACTAGTGGATCTG
B. Primers used for the confirmation of successful gene disruption in yeast chromosome
 C-ERG3_Fw1 CGAAACGACGCCTTTTGTTGCGATTGTCG
 C-ERG3_Rv1 ATTTGTGTGCTTCTCTTGACGTTCGTTCG
 C-ERG3_Fw2 TTCAACAAGTTTCAATAGCTCATCAGTCG
 C-ERG3_Rv2 GAAATCTTGGGCATTTTAAAGCTTCCAGC
 C-NCE103_Fw1 GTCACCATGACGCTTATCAAGCC
 C-NCE103_Rv1 ATCGGGCGTTTACCGTATCGC
 C-NCE103_Fw2 CTACACCTGGGGTCATGATTAGCC
 C-NCE103_Rv2 GACATTTGCTGGATCACAGACCG
C. Primers used in the PCR amplification of the GAL1 promoter derivative fused with hCAII
 pGAL1.4 Fw TACAGCTAAGACTACAAAACGGATTAGAAGCCGCCG
 pGAL1.3 Fw TACAGCTAAGACTACAAACCGAGCGGGCGACAGCCC
 pGAL1.2 Fw TACAGCTAAGACTACAAACCGACGGAAGACTCTCCTC
 pGAL1.1 Fw TACAGCTAAGACTACAAAGCAGATGTGCCTCGCGCC
 NotI_hCAII Rv TTTTCCTTTTGCGGCCGCTTTTTTCCTTTTATTTATCATCATCATCTTTG