Skip to main content

Table 2 Primers used for real-time PCR

From: Impacts of selenium and vitamin E supplementation on mRNA of heat shock proteins, selenoproteins and antioxidants in broilers exposed to high temperature

Target gene Accession no. Primer sequence (5′–3′) Product (bp)
GAPDH K01458 Forward: TGAAAGTCGGAGTCAACGGAT
Reverse: ACGCTCCTGGAAGATAGTGAT
230
GPx1 HM590226 Forward: AACCAATTCGGGCACCAG
Reverse: CCGTTCACCTCGCACTTCTC
122
GPx4 AF498316 Forward: CATCACCAACGTGGCGTCCAA
Reverse: GCAGCCCCTTCTCAGCGTATC
92
HSP70 AY288298 Forward: AGCGTAACACCACCATTCC
Reverse: TGGCTCCCACCCTATCTC
372
HSP60 NM001012916.1 Forward: AGCCAAAGGGCAGAAATG
Reverse: TACAGCAACAACCTGAAGACC
115
HSP90 NM0010149164 Forward: TCCTGTCCTGGCTTTAGTTT
Reverse: AGGTGGCATCTCCTCGGT-3
162
SelP NM_001031609 Forward: GAGGGACTGGTCAACATCTCATACG
Reverse: GGGAAGACCCAGGTGGTACACT
216