Table 1 Primers, plasmids and strains used in this study
Primer, plasmid or strains | Description or Genotype | Source or reference |
|---|---|---|
Primer | ||
 P1 (LPO1-F) NdeI | ggggcatatgaaagctactaaactggtactgggcaacccgtatgttggctttgaaatggg | Tafakori et al. (2012) |
 P2 (LPO3-R) EcoRI | gggggaattccggtctgcggcagcggaatgccgttgtccggacg | MWG |
 P1(SRTA3-F) SphI | gggggcatgccaagctaaacctcaaattcc | MWG |
 P2(SRTA2-R) PstI | ggggctgcagttatttgacttctgtagcta | MWG |
Plasmid | ||
 PQE | T5 promoter, 6×His-tag coding sequence, β-lactamase coding sequence, Amp r | Qiagen |
 PET 26b | T7 promoter, an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His·Tag | Novagene |
 PET 26b-lOAE (pLOAE) | Vector for construction and expressing of chimeric protein containing lpp′-ompA, Elongatus and Chitin Binding domain | Constructed in this study Constructed in this srudy |
 pSRTA | Vector for construction and expressing of SrtA | NIGEB collection |
 SrtA∆N | Vector for construction and expressing of SrtAΔ59 (StrAT) | NIGEB collection |
 pQE30 |  |  |
Strain | ||
 BL21 DE3 | F– ompT gal dcm lon hsdSB (rB- mB-) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5] | Stratagene |
 Top 10 Staphylococcus aureus | F′[lacIq Tn10 (tetR)] mcrA Δ (mrr-hsdRMS-mcrBC) \( \varphi \) 80lacZΔM15 ΔlacX74 deoR nupG recA1 araD139 ∆(araleu) 7697 galU galK rpsL(StrR) endA1 λ− | Invitrogen |