Skip to main content

Table 1 Primers used for construction of mutants and plasmids

From: Poly-l-gamma-glutamic acid production by recombinant Bacillus subtilis without pgsA gene

Primer names Sequence (5′→3′)
Cmr Fw CAACTAAAGCACCCATTAGTTCAACAAACG
Cmr Rv CTTCAACTAACGGGGCAGGTTAGTGAC
BCA-Dw Fw CAAGCCCCGAGCAATCA
BCA-Dw Rv CTAATGGGTGCTTTAGTTGTCGGAGTGATAAAGATGAAATTTGTC
BCA-Up Fw CTGCCCCGTTAGTTGAAGTGCTTTTCGACATCTCCTT
BCA-Up Rv AAGGGTTTGTGATATCCGG
P_S237 Fw CAACTAAAGCACCCATTAGGGATCCAACAGGCTTATATTTAGAG
P_S237 Rv CATCATATTACCTCCTAAATATTTTTAAAGTA
Bsu pgsA Rv CGAAGCTTAGATGGCTTTGACAAATTTCATC
Bsu pgsC Rv CCCAAGCTTGACCTTCGGCGTTTCCGCT
Bsu pgsB Rv CCCAAGCTTGGCAGCGAATTTTCTGCGTCC
Bsu pgsA Fw ATTTAGGAGGTAATATGATGAAAAAAGAACTGAGCTTTCATG
Bsu pgsC Fw ATTTAGGAGGTAATATGATGTTCGGATCAGATTTATACATC
Bsu pgsB Fw ATTTAGGAGGTAATATGATGTGGTTACTCATTATAGCCTG
Bsu pgsBA Fw CGTAAGCTAGGGGGAAATGCAGACGATGAAAAAAGAACTGAGCTTTCATG
pHY-P_S237 Rv CATCATATTACCTCCTAAATATTTTTAAAGTA
pHY Fw TAGAAGCTTGGGCAAAGCGTTTTTCCA
Bam pgsB Fw GGAGGTAATATGATGTGGTTACTCATTATAGCCTGTG
Bli pgsB Fw GGAGGTAATATGATGTGGGTAATGCTATTAGCCTGTG
Obi pgsB Fw GGAGGTAATATGATGCTAGAAGAATTTTTAATCATTT
Bam pgsC Rv TTGCCCAAGCTTCTACCTTCCCTGTCAGGATGCAG
Bli pgsC Rv TTGCCCAAGCTTCTACTTCCGACCCAAGTAAAGAC
  1. Italic sequences represent synthesized restriction enzyme sites; underlined sequences represent homologous regions for spliced overlapping extension (SOE)-PCR; bold sequences represent initiation codons for the open reading frames (ORFs) of each gene
\