Skip to main content

Table 2 Primers used in this study

From: Rapid monitoring of the target protein expression with a fluorescent signal based on a dicistronic construct in Escherichia coli

Primer Sequence 5′–3′ Restriction site
1mF GGATCTGCATATGGTCTCTAAAGGCGAGGAAG NdeI
1mR CGGGATCCTTATTTGTACAGTTCGTCCATG BamHI
2mF CCCAAGCTTAAGAAGGAGATATACATATG
GTCTCTAAAGGCG
HindIII
2mR CCGCTCGAGTTATTTGTACAGTTCGTCCATG XhoI
2m1F GGAATTCCTAGAGCTCCGTCGACAAG EcoRI
2m2F GGAATTCCTAATAGAGCTCCGTCGACAAG EcoRI
2m3F GGAATTCCTAATAAGGGAGCTCCGTCGACAAG EcoRI
2eF CGGGATCCATGGTAAGCAAGGGTGAG BamHI
2eR CCCAAGCTTCTTTGTACAGTTCATCCATG HindIII
2e1F CGGGATCCATGCTAGTAAGCAAGGGTGAG BamHI
2e2F CGGGATCCATGCTAATAGTAAGCAAGGGTGAG BamHI
  1. Rare codons are represented in bold, and restriction enzyme sites are indicated with underline