Skip to main content

Table 3 The primer NS5-3 used for detection of Zika virus

From: Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification

Primers Sequence (5′ → 3′) Length (bp)
F3 GCCAACAAAGAGTCTTCAAAG 21
B3 ACAACTATGGCACTCTCCT 19
FIP (F1c + F2) AGACACGTGGCCGCTTACGCCAGGTAATGAACATGGT 37
BIP (B1c + B2) GCAGCACTGGGAGCAATATTTGACCTTGGATCATTCACAGC 41
LoopF CCTTCCACAGCCAGGAAG 18
LoopB AATGGAAGACGGCTGTGG 18