Skip to main content

Table 2 The primer NS5-2 used for detection of Zika virus

From: Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification

Primers Sequence (5′ → 3′) Length (bp)
F3 CATCTTCCCTCGTGAATGG 19
B3 ACCTTGTTGATGAACTCTTCTT 22
FIP (F1c + F2) CGGTGTGGTGTCAGTCATAGCGGTTGTTAGACTCCTGTCAAA 42
BIP (B1c + B2) GACACCAGGGTGCCAGACGGAAGCGACCATGTTCAT 36
LoopF CCTGTAACTCCAGTCACCAC 20
LoopB AGAAGGTACTCGCCAGGT 18