Skip to main content

Table 1 The primer NS5-1 used for detection of Zika virus

From: Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification

Primers Sequence (5′ → 3′) Length (bp)
F3 GCTATGACTGACACCACAC 19
B3 ACCTTGGATCATTCACAGC 19
FIP (F1c + F2) CCAGCTCCTTCCACAGCCCAAGAAGGTACTCGCCAG 36
BIP (B1c + B2) TAAGCGGCCACGTGTCTGAATATTGCTCCCAGTGCTG 37
LoopF AGGAAGCGACCATGTTCATT 20
LoopB GAAGAGTTCATCAACAAGGTGC 22