Skip to main content

Table 2 Target sequences used in this study

From: Genetic and physiological basis for antibody production by Kluyveromyces marxianus

Name Sequence (5′ → 3′)
gRNA-1 TATAAAATGTCGCTGTGACC
gRNA-2 CAACTACAACCGGATACCTG
gRNA-3 ATGGAAGCAAGAGGGAGTAT