Skip to main content

Table 1 Genes and corresponding primers for the real-time qPCR

From: Biodegradation of decabromodiphenyl ether (BDE 209) by a newly isolated bacterium from an e-waste recycling area

Gene name Gene ID Gene function Forward (5′ to 3′) Reverse (5′ to 3′) References
16S rRNA Reference gene CGGTGAATACGTTCYCGG GGWTACCTTGTTACGACTT Wang et al. (2015)
Hydrolase CCR98_00905 Alpha/beta hydrolase AGCTATTACTGGCGCACGTT TGTACTCGTAGCGGCTGTCA Wu et al. (2017)
Dioxygenase CCR98_02495 Aromatic ring-opening dioxygenase AAGGCCGAGCAGGATTATCT GACAGCGTCATGCTCTTCAC Wu et al. (2017)
Dehalogenase gene 1 CCR98_02005 Haloacid dehalogenase ATCTGTTCGCCTCGCTGAT ATAGACCGAAATGCCAGCAC Wu et al. (2017)
Dehalogenase gene 2 CCR98_19135 Haloacid dehalogenase CAGCATCACCCACAACCTG CTGCTCTACCCACTCGATGAA Wu et al. (2017)