Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Presence of Chlamydia trachomatis and Mycoplasma spp., but not Neisseria gonorrhoeae and Treponema pallidum, in women undergoing an infertility evaluation: high prevalence of tetracycline resistance gene tet(M)

PCR Target Primer/probe Sequence (5′–3′) Size (bp) Ref
Generic for 11 Chlamydia species 23S rRNA UP1 GGGGTTGTAGGRTTGRGGAWAAAGGATC 168 Guo et al. (2016)
UP2 GGGGTTGTAGGGTCGATAAYATGRGATC
DN GAGAGTGGTCTCCCCAGATTCARACTA
FLU1 ACGAAAGGAGAKMAAGACYGACCTCAAC-6-FAM
FLU2 ACGAAAAAACAAGAGACTCTATTCGAT-6-FAM
LCRed LCRed640-CCTGAGTAGRRCTAGACACGTGAAAC-P
Generic for Mycoplasma species 16S rRNA UP CTGCCTGAGTAGTAYRYTCGCAA 174 This study
DN TGCACCATCTGTCACTHBGTTARCCTC
FLU AAACCACATGCTCCACCGCTTGT-36-FAM
LCRed LCRed640-GGTCCCCGTCAATTCCTTTAAGTTT-P
Mycoplasma species for sequencing 16S rRNA UP ACTCCTACGGGAGGCAGCAGTA 700 Yoshida et al. (2002)
DN TGCACCATCTGTCACTCTGTTAACCTC
N. gonorrhoeae porA pseudogene UP CGGTTTCCGTGCGTTACGA 132 Whiley et al. (2004)
DN AACTGGTTTCATCTGATTACTTTCCA
FLU CATTCAATTTGTTCCGAGTCAAAACAGC-6-FAM
LCRed LCRed640-AGTCCGCCTATACGCCTGCTACTTTCAC-P
T. pallidum polA UP GGTAGAAGGGAGGGCTAGTA 104 Heymans et al. (2010)
DN CTAAGATCTCTATTTTCTATAGGTATGG
TaqMan probe FAM-ACACAGCACTCGTCTTCAACTCC-BHQ1
RPPs gene   UP CCACCGAATCCTTTCTGGGC 245 This study
DN ATCCGAAAATCTGCTGGGGTACT