Skip to main content

Table 1 Primers used in this study

From: Improving cellulase production in submerged fermentation by the expression of a Vitreoscilla hemoglobin in Trichoderma reesei

Primer Primer sequence (5′–3′)
VHb-F AGACATCACAATGTTAGACCAGCAAACCAT
VHb-R TTAATGATGATGATGATGATGTTCAACCGCTTGAGCGTA
TRP-F ATCATCATCATCATCATTAAGGATCCACTTAACGTTACTG
GPD-R GGTCTAACATTGTGATGTCTGCTCAAGCGG
TF AAGGATTTCGGCACGGCTAC
TR GCACTCTTTGCTGCTTGGAC
M13F GTAAAACGACGGCCAGT
M13R CAGGAAACAGCTATGACC
  1. The underlined nucleotide sequence represents the C-terminal 6×His tag