Skip to main content

Table 1 PCR primers and conditions used for isolates identification

From: Evaluation of microbial consortia and chemical changes in spontaneous maize bran fermentation

Primers Target Sequence (5′–3′) Thermal conditions Amplicon (bp) References
RSA_F
RSA_R
16S–23S rDNA spacer region (RSA) GAAGTCGTAACAAGG
CAAGGCATCCACCGT
94 °C × 45 s
54 °C × 1 min × 35 cycles
Variable Lane (1991)
16S_F
16S_R
16S rDNA gene AGAGTTTGATCCTGGCTCAG
CTACGGCTACCTTGTTACGA
94 °C × 45 s
55 °C × 45 s × 35 cycles
1540 Lane (1991)
p8FLP
p806R
Partial 16S rDNA gene AGTTTGATCCTGGCTCAG
GGACTACCAGGGTATCTAAT
94 °C × 1 min
56 °C × 1 min × 30 cycles
800 McCabe et al. (1995)
L. plant_F
L. plant_R
L. plantarum CCGTTTATGCGGAACACC
TCGGGATTACCAAACATCAC
94 °C × 2 min
56 °C × 1 min × 35 cycles
318 Torriani et al. (2001)
Pedio23S_F
Pedio23S_R
Pediococcus spp. GAACTCGTGTACGTTGAAAAGTGCTGA
GCGTCCCTCCATTGTTCAAACAAG
94 °C × 45 s
64 °C × 1 min × 35 cycles
701 Pfannebecker and Fröhlich (2008)
P23S_R
PPE23S_F
P. pentosaceus CTGTCTCGCAGTCAAGCTC
CCAGGTTGAAGGTGCAGTAAAAT
94 °C × 1 min
67 °C × 1 min × 35 cycles
1640 Pfannebecker and Fröhlich (2008)
P23S-R
ArgentF
P. argentinicus CTGTCTCGCAGTCAAGCTC
GATATTCCTGTACTAGTTAGAT
94 °C × 1 min
60 °C × 1 min × 35 cycles
948 This study
Lbrev
1391F
L. brevis TAATGATGACCTTGCGGTC
TGTACACACCGCCCGTC
94 °C × 45 s
48 °C × 45 s × 35 cycles
330 Coton et al. (2008)
Weiss_F
Weiss_R
Weissella spp. CGTGGGAAACCTACCTCTTA
CCCTCAAACATCTAGCAC
94 °C × 45 s
54 °C × 1 min × 35 cycles
725 Jang et al. (2002)
1 RL
LaccreR
L. lactis TTTGAGAGTTTGATCCTGG
GGGATCATCTTTGAGTGAT
94 °C × 2 min
54 °C × 1 min × 35 cycles
238 Pu et al. (2002)
LeuclacF
LeuclacR
L. lactis AGGCGGCTTACTGGACAAC
CTTAGACGGCTCCTTCCAT
94 °C × 2 min
58 °C × 1 min × 35 cycles
742 Lee et al. (2000)
ITS1
ITS4
ITS1-5.8S-ITS2 Internal Transcribed Spacer (ITS) TCCGTAGGTGAACCTGCGG
TCCTCCGCTTATTGATATGC
94 °C × 45 s
60 °C × 1 min × 35 cycles
Variable Jespersen et al. (2005)
NL1
NL4
26S rDNA gene GCATATCAATAAGCGGAGGAAAAG
GGTCCGTGTTTCAAGACGG
94 °C × 2 min
52 °C × 1 min × 35 cycles
778 Kurtzman and Robnett (1998)