Skip to main content

Table 1 The primers used in qRT-PCR

From: Hydrogen-rich water increases postharvest quality by enhancing antioxidant capacity in Hypsizygus marmoreus

  Sequences (5′–3′) Accession number
cat-F CAACCGTCCGTTTCTCCACT GBCL00039326
cat-R CCAATCCCAATTACCTTCCTC
sod-F GCAATGGCGGCACTCTGAAA GBCL00008983
sod-R CAAGAGCGGGTCCTGGTTCG
apx-F TGAACCTCCACCGTACACCA KYQ43457
apx-R GGCTTCCGAACCATCCAC
gr-F AGCAAGCCTTCCGACGAGCAA GBCL00010302
gr-R CGACGGCGATGTAGCCAGCA
18 s-F GAGGGACCTGAGAAACG KC510993
18 s-R ATAAGACCCGAAAGAGCC