Skip to main content

Table 1 Nucleotide sequences of oligonucleotides designed for assembly of mu-IFN-CSP

From: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression

Primers Nucleotide sequence (from 5′ end to 3′ end)
MuIC-1 GGAATTCCATATG TGTGATCTGCCTCAGA
MuIC-2 GTGCCAGGAGAATCAAGGCACGACGGTTACCCAGGCTGTGAGTCTGAGGCAGATCACA
MuIC-3 GCCTTGATTCTCCTGGCACAAATGCGTCGTATCTCTCCTTTCTCCTGCCTGAAGGACC
MuIC-4 TATCATCAAACTCCTCCTGTGGGAATTCAAAGTCATGACGGTCCTTCAGGCAGGAGAA
MuIC-5 CAGGAGGAGTTTGATGATAAACAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATG
MuIC-6 CTTTTGTGGTAAAGAGGTTGAAGATCTGCTGGATCATCTCATGGAGGACAGAGATGGC
MuIC-7 AACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTTGACAAAT
MuIC-8 CTTCCAAGTCATTCAGCTGCTGGTAGAGTTCGGTGCAGAATTTGTCAAGGAGGTCCTC
MuIC-9 CAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGCGTGTGGGAGAAACTCCAC
MuIC-10 AGTATTTCTTCACAGCCAAGATGGAGTCCGCATTCATCAGTGGAGTTTCTCCCACACG
MuIC-11 TTGGCTGTGAAGAAATACTTCCGTCGTATCACTCTCTATCTGACAGAGAAGAAATACA
MuIC-12 GCATGATTTCTGCACGGACAACCTCCCAGGCACAAGGGCTGTATTTCTTCTCTGTCAG
MuIC-13 GTCCGTGCAGAAATCATGCGTTCCCTCTCTTTATCAACAAACTTGCAAGAACGTTTAC
MuIC-14 CGTAATTTCTCGTTGTCTTCCTTACGACGTAAACGTTCTTGCAAGTT
MuIC-15 GACAACGAGAAATTACGTAAACCAAAACATAAAAAATTAAAGCAACCAGCGGA
MuIC-16 CCGCTCGAGACCATCCGCTGGTTGCTTTAA
  1. Letters in bold type denote the overlapped parts in Mu-IFN-CSP. Restriction sites are underlined